Problem Set: Unix 1

Unix Basics: Quick Review
=========================
 
ls       -- list contents
cd       -- change directory
mkdir    -- make a directory
rm       -- use caution, it is easy to delete more that you would like
head     -- prints the top few lines to the terminal window
tail     -- prints the last few lines to the terminal window
sort     -- sorts the lines
uniq     -- prints the unique lines
grep     -- filnds the lines that contain a pattern
wc       -- counts the number of lines, characters and words
mv       -- move files
cp       -- copy files
date     -- returns the current date and time
pwd      -- return working directory name
ssh      -- remote login
scp      -- remote secure copy
~        -- represents your home directory
 
man [command] -- manual page for the command
man ls
 
try:
 
ls -l
 
ls -lt
 
you can string more than one command together with a pipe (|) , such that the output of the first command is received by the second command.
 
ls -lt | head
 
you can string more than one command together with a semi-colon (;) , such that the commands run sequentially, but that output does not get passed into the next command.
 
date; some program command ; date
 
you can redirect the output of a command into a file
 
grep PATTERN > PATTERN.txt
 
you can append the output of a command to a file
 
    grep PATTERN2 >> PATTERN.txt
 
you can redirect stderr to a file
 
    command 2> filename
 
you can redirect the output (stdout) and stderr to a file
 
    command &> filename
 
text editors:
 
    text wrangler is a good app to start with.
 
===============
Unix Problem Set
================
 
    Using your text editor create a fasta file with a few of your favorite sequecnes and name it sequences.fasta. Make sure it ends up in the proper directory, locally or remotely.
 
    This is fasta file format:
    >seqName description
    ATGGCGTCTTGGCCTTAAAAGCTC
 
    1. Log into your machine or account. 
    2. What is the full path to your home directory?
    3. Go up one directory?
        - How many files does it contain?
        - How many directories?
    4. Without using a text editor examine the contents of the file sequences.fasta.
        - How many lines does this file contain?   
        - How many characters?    (Hint: check out the options of wc)
        - What is the first line of this file?    (Hint: read the man page of head)
        - What are the last 3 lines?    (Hint: read the man page of tail)
        - How many sequences are in the file?    (Hint: use grep)
    5. Rename sequences.fasta to something more informative of the sequences the file contains. (Hint: read the man page for mv)
 
    6. Create a directory called fasta.     (Hint: use mkdir)
    7. Copy the fasta file that you renamed to the fasta directory. (Hint: use cp)
    8. Verify that the file is within the fasta directory.    (Hint: use ls fasta/)
    9. Delete the the original file that you used for copying.    (Hint: use rm, be careful)
    10. Read the man page for rm and cp to find out how to remove and copy a directory.
    11. Print out your history and redirect it to a file called unixBasics.history.txt
 
    12. In /home/pfb2013/data there is a file called: cuffdiff.txt
	- look at the first few lines of the file
	- sort the file by log fold change 'log2(fold_change)', from highest to lowest, and save in a new file in your directory called sorted.cuffdiff.out
  	- sort the file (log fold change highest to lowest) then print out only the first 100 lines. Save in a file called top100.sorted.cuffdiff.out
	- Sort the file, print only first column. Get a unique list of the genes, then print only the top 100. Save in a file called differentially.expressed.genes.txt