Perl IV Problem Set
==================
1. Iterate through each element of this array using a foreach loop: (101,2,15,22,95,33,2,27,72,15,52);
   - Print out only the values that are even (use modulus operator).



#!/usr/bin/perl
#PerlIV-1.pl
                                                                                                                                                                                      
use warnings;
use strict;

my @numbers = ("101", "2" , "15","22", "95", "33", "2", "27", "72", "15", "52");
foreach my $number (@numbers){
  if($number % 2 ==0){
     print $number,"\n";
                   }
}




2. Iterate through each of the elements of the above array, but sort them numerically.
   - Print each element.
   - Create two cumulative sums, one of all the even values and one of all the odd values. 
   - Print the two sums.


#!/usr/bin/perl
# Perl IV Problem 2
#################
use warnings;
use strict;

my @ar = ("101","2","15","22","95","33","2","27","72","15","52");
my $even_sum = 0;
my $odd_sum = 0;

 
foreach my $item (sort {$a <=> $b} @ar)
{
  print $item,"\n";  # print each element

  if($item % 2 == 0)
  {
    $even_sum += $item; # $even_sum = $even_sum + $item
  }
  else
  {
    $odd_sum += $item; # $odd_sum = $odd_sum + $item
  }
}




3. Iterate through each element in the this array (101,2,15,22,95,33,2,27,72,15,52) using a for loop.
   - Print only the values of the indices that are odd  

#!/usr/bin/perl

use strict;
use warnings;

my @array = (101, 2, 15, 22, 95, 33, 2, 27, 72, 15, 52);
   for (my $i = 0; $i < scalar(@array); $i++)
   {
	my $member = $array[$i];
	   if ($member % 2 !== 0){
	   print $member, "\n";
	   }
}




4. Using the sort() function with numbers
   - Sort the array with the default sort function and store the new sorted array.
   - print out the array. Are they sorted numerically?
   - customize the sort function to sort the numbers numerically, and store the new sorted array.
   - print out the array. Are they sorted numerically?
   - reverse the numeric sort (hint, switch $a and $b), and store the new sorted array.
   - print out the array. Are they sorted numerically, biggest to smallest?


#!/usr/bin/perl                                                                                                                                                                                      

use strict;
use warnings;

my @array = (101,2,15,22,95,33,2,27,72,15,52);
my @sorted_array = sort (@array);
print @sorted_array,"\n";
@sorted_array = sort ( { $a <=> $b } @array);
print @sorted_array, "\n";
@sorted_array = sort ( { $b <=> $a } @array);
print @sorted_array,"\n";




5. Using pop, push, shift, unshift with this array (101,2,15,22,95,33,2,27,72,15,52)
   - use pop on this array. Store the result of pop in a variable. Print the contents of this variable. Print the array. How is the array different from before the use of pop?
   - use shift on the original array. Store the result of shift in a variable. Print the contents of this variable. Print the array. How is the array different from before the use of shift?
   - use push on the original array with the number 12. Print the array. How is the array different from before the use of push?
   - use unshift on the original array with the number 4. Print the array. How is the array different from before the use of unshift?



#!/usr/bin/perl                                                                                                                                                                                   
##pop##

use strict;
use warnings;

my @array = (101, 2, 15, 22, 95, 33, 2, 27, 72, 15, 52);
my $number = pop (@array);
print $number,"\n";
print join('--', @array),"\n";


#!/usr/bin/perl                                                                                                                                                                                  
##shift##

use strict;
use warnings;

my @array = (101, 2, 15, 22, 95, 33, 2, 27, 72, 15, 52);
my $first = shift(@array);
print $first,"\n";
print join('--', @array),"\n";



#!/usr/bin/perl                                                                                                                                                                                  
##push##

use strict;
use warnings;

my @array = (101, 2, 15, 22, 95, 33, 2, 27, 72, 15, 52);
push(@array, '12');
print join('--', @array),"\n";



!#/usr/bin/perl
##unshift##

use strict;
use warnings;

my @array = (101, 2, 15, 22, 95, 33, 2, 27, 72, 15, 52);
unshift(@array, '4');
print join('--', @array),"\n";




6.  Run this code. Is its output what you expect? Why?
                  for (my $i = 0; $i < 10; $i++) {
                   if ($i = 2) {
                       print "\$i = $i\n";
                   }
                  }

#needs == rather than = (assignment operator)



7. Using the sort function with strings: use this array: ('ATGCCCGGCCCGGC','GCGTGCTAGCAATACGATAAACCGG', 'ATATATATCGAT','ATGGGCCC') 

8. Calculate GC content of one sequence
   Turn a ONE of the above DNA strings into an array with split()
   Use a foreach loop to look at each nucleotide in turn
   Calculate total length of the sequence
   Keep a running total of C's and G's
   Print the calculated GC content as a percent.


#!/usr/bin/perl                                                                                                  

use strict;
use warnings;

  my @array = ('ATGCCCGGCCCGGC','GCGTGCTAGCAATACGATAAACCGG', 'ATATATATCGAT','ATGGGCCC');
  my $sequence =  shift ( @array);
  my @sequence = split (//, $sequence);
  my $total_length = 0;
  my $GC_count = 0;

foreach my $nucl (@sequence){
  if ( ($nucl eq "C") or ( $nucl eq "G") ){
        $GC_count++;
      }
     $total_length++
   }
   print $total_length,"\n";
   my $percent_GC = ($GC_count/$total_length)*100;
   print $percent_GC,"\n";



9. Place your GC content calculator code into an array, and calculate the GC content of each of the sequences in the above array. 
 shift each element off array



10. Create a shuffled sequence
  Turn a DNA string into an array with split()
  Use a for loop to perform the following procedure N times (N = length of seq)
    Select a random position A with rand()
    Select a random position B with rand()
    Exchange the letters at array indices A and B
    (remember you can reassign any value in an array: $array[4] = "new value";)
  Print the now shuffled sequence


  
#!/usr/bin/perl                                                                                                                                                                                      
use warnings;
use strict;

my $sequence = 'ATGCCCGGCCCGGC';
my @nucleotides = split //, $sequence;

my $length = length ($sequence);  #or = scalar(@nucleotides)                                                                                                                                         
for (my $i = 0; $i < $length; $i++){
    my $pos1 = int (rand ($length));
    my $pos2 = int (rand ($length));
    ($nucleotides[$pos1], $nucleotides[$pos2]) = ($nucleotides[$pos2], $nucleotides[$pos1]);
}    
print join ("", @nucleotides),"\n";



 
11a. Start with 2 very similar DNA sequences. 
  Align with ClustalW, TCoffee, or some other web alignment application. 
  Output should be in FASTA format.
  Store (copy and paste) the sequence, including dashes, from each ClustalW fasta output in a separate string variable inside your script.
  Turn each string into an array with split()
  Use a for loop to compare each index for nucleotide differences.
  Report the nucleotide position of each difference.

#!/usr/bin/perl

use strict;
use warnings;

my $al_seq1 = "ATGTCC---GT-GGCC"; # Aligned sequence 1
my $al_seq2 = "--CTCCATCGTT-GCC"; # Aligned sequence 2
my $size = length($al_seq1);

my @seq1 = split(//,$al_seq1);
my @seq2 = split(//,$al_seq2);

print "$al_seq1\n";
print "$al_seq2\n";
for(my $c = 0; $c < $size; $c++)
{
  if ($seq1[$c] ne $seq2[$c])
  {
    print "Difference at $c\n";
  }
}

 
11b. Do the same as above but instead of coping and pasting into string variables
import from a file.