Perl VII Problem Set ===================== 1. Create a subroutine that reverse complements a sequence. This subroutine should take a nucleotide sequence as a parameter and return the reverse complement. Here's the pseudo code: -- BEGIN PSEUDOCODE -- subroutine reverse_complement { get the parameter nucleotide string reverse complement the nucleotide string return the complemented nucleotide string } -- END PSEUDOCODE -- Write a program that takes in a nucleotide string as an argument, calls the reverse_complement subroutine, and then prints the reverse complement sequence to STDOUT. -- BEGIN SAMPLE RUN -- ./reverse_complement.pl GAGAGAGAGAGTTTTTTTTT AAAAAAAAACTCTCTCTCTC -- END SAMPLE RUN -- 2. Create a subroutine that reformats your FASTA file such that the sequence is reformatted so that it contains certain number of nucleotides per line. For example: reformat_seq ($seq , 60 ); ## sequence before >seq 1 GAATTCAAGTTCTTGTGCGCACACAAATCCAATAAAAACTATTGTGCACACAGACGCGACTTCGCGGTCTCGCTTGTTCTTGTTGTATTCGTATTTTCATTTCTCGTTCTGTTTCTACTT AACAATGTGGTGATAATATAAAAAATAAAGCAATTCAAAAGTGTATGACTTAATTAATGAGCGATTTTTTTTTTGAAATCAAATTTTTGGAACATTTTTTTTAAATTCAAATTTTGGCGA AAATTCAATATCGGTTCTACTATCCATAATATAATTCATCAGGAATACATCTTCAAAGGCAAACGGTGACAACAAAATTCAGGCAATTCAGGCAAATACCGAATGACCAGCTTGGTTATC ## sequence after >seq 1 GAATTCAAGTTCTTGTGCGCACACAAATCCAATAAAAACTATTGTGCACACAGACGCGAC TTCGCGGTCTCGCTTGTTCTTGTTGTATTCGTATTTTCATTTCTCGTTCTGTTTCTACTT AACAATGTGGTGATAATATAAAAAATAAAGCAATTCAAAAGTGTATGACTTAATTAATGA GCGATTTTTTTTTTGAAATCAAATTTTTGGAACATTTTTTTTAAATTCAAATTTTGGCGA AAATTCAATATCGGTTCTACTATCCATAATATAATTCATCAGGAATACATCTTCAAAGGC AAACGGTGACAACAAAATTCAGGCAATTCAGGCAAATACCGAATGACCAGCTTGGTTATC 3. Create a subroutine in which you pass in a FASTA file name and in which you return an array of the id followed by sequence. Your returned values will be formatted as follows: (id1, seq1, id2, seq2, id3, seq3, id4, seq4) my @seq_records = fastaParser ($fasta_file_name); How will you handle new lines in your sequences (sequences that have multiple lines of sequence per record).