Unix Basics

ls       -- list contents
cd       -- change directory
mkdir    -- make a directory
rm       -- use caution, it is easy to delete more that you would like
head     -- prints the top few lines to the terminal window
tail     -- prints the last few lines to the terminal window
sort     -- sorts the lines
uniq     -- prints the unique lines
grep     -- filnds the lines that contain a pattern
wc       -- counts the number of lines, characters and words
mv       -- move files
cp       -- copy files
date     -- returns the current date and time
pwd      -- return working directory name
ssh      -- remote login
scp      -- remote secure copy
~        -- represents your home directory

man [command] -- manual page for the command
man ls

try:

ls -l

ls -lt

you can string more than one command together with a pipe (|) , such that the output of the first command is received by the second command.

ls -lt | head

you can string more than one command together with a semi-colon (;) , such that the commands run sequentially, but that output does not get passed into the next command.

date; some program command ; date

you can redirect the output of a command into a file

grep PATTERN > PATTERN.txt


you can append the output of a command to a file
   
    grep PATTERN2 >> PATTERN.txt


you can redirect stderr to a file
   
    command 2> filename

you can redirect the output (stdout) and stderr to a file
   
    command &> filename

text editors:
   
    text wrangler is a good app to start with.

============
Problem Set
============

    Using your text editor create a fasta file and name it sequences.fasta. Make sure it ends up in the proper directory, locally or remotely.

    This is fasta file format:
    >seqName description
    ATGGCGTCTTGGCCTTAAAAGCTC

    Log into your machine or account. What is the full path to your home directory?
        How many files does it contain?
        How many directories?
    Without using a text editor examine the contents of the file sequences.fasta.
        How many lines does this file contain?   
        How many characters?    (Hint: check out the options of wc)
        What is the first line of this file?    (Hint: read the man page of head)
        What are the last 3 lines?    (Hint: read the man page of tail)
        How many sequences are in the file?    (Hint: use grep)
    Rename sequences.fasta to something more informative of the sequences the file contains.    

(Hint: read the man page for mv)

    Create a directory called fasta.     (Hint: use mkdir)
    Copy the fasta file that you renamed to the fasta directory. (Hint: use cp)
    Verify that the file is within the fasta directory.    (Hint: use ls fasta/)
    Delete the the original file that you used for copying.    (Hint: use rm, be careful)
    Read the man page for rm and cp to find out how to remove and copy a directory.