Perl Basics

Why Perl for data processing & bioinformatics

    - Fast text processing
    - Regular expressions
    - Extensive module libraries for pre-written tools
    - Large number of users in community of bioinformatics
    - Scripts are often faster to write than full compiled programs



Every perl script needs to contain the following line:

    #!/usr/bin/perl
    use warnings;
    use strict;
 

Print "hello world". Type this into your text editor and save it. Give the script a .pl extension.
   
    #!/usr/bin/perl
    use warnings;
    print "hello world\n";

Run it:
    on the command line type
    perl your_script_name.pl

Try it without a new line character (\n).

Using variables:
    $scalar        A scalar contains a value, can be a string or a number.

@array    An array contains a list of values.
    %hash        A hash contains paired values (key/value pairs)

Using a scalar to print:
    #!/usr/bin/perl
    use warnings;
    $phrase = "hello world";
    print "$phrase\n";
   
    # This is a comment
    # A print statement can combine variables and strings
    print "This is my phrase $phrase\n";

    # this is another way to print the same as above
    # the print function takes a list of arguments
    # in this example "This is my phrase $phrase" is the first argument
    # and "\n" is the second
    print "This is my phrase $phrase" , "\n";

Scope:  (we will go over this concept in more detail at a later time)

use strict;

my, use "my" only when declaring a variable, when it is first mentioned.


Getting information from the user:

    #!/usr/bin/perl
    use warnings;
    use strict;

    my $word1 = shift; # the arguments provided on the command line are saved in an
		       # array. shift is a function that "shifts" the first item off of the array.
    my $word2 = shift;

    print "$word2\t$word1\n"; # \t is a tab character

Something Advanced but fun     tr///
   
    #!/usr/bin/perl
    use warnings;
    use strict;

    my $pet = "cat";
    print $pet, "\n";

    $pet =~ tr/cat/dog/;

    print $pet , "\n";

    $pet =~ tr/o/O/;
    print $pet, "\n";
   
    dOg
   
    $pet =~ tr/gd/wc/;
    print $pet, "\n";



Documentation of perl scripts and modules

    Perldoc online http://perldoc.perl.org/
    Or on your computer - type 'perldoc'
    For functions use -f 'perldoc -f sprintf'
    For modules just the name 'perldoc List::Util'
    http://www.cpan.org



Problem Set

    Create a script called "add.pl" script to sum two $scalar variables:

    (hint:     use + )

    

    Modify this script so that it gets both variables from the command line


        

    Create a script to produce the reverse complement of a sequence (hint, use the reverse and tr/// functions)

    reversec.pl GAGAGAGAGAGTTTTTTTTT
    output: AAAAAAAAACTCTCTCTCTC